YEAST STRAINS The yeast strains we now use for the interaction trap were made by Erica Golemis. The most important feature of these strains is that they contain a selectable gene, LEU2, which has upstream LexA binding sites (LexA operators; LexAop) in place of its normal upstream activating sequences (UAS). The LexAop-LEU2 gene replaces the chromosomal LEU2 gene and therefore is stable (requires no selection to maintain it). The LexAop-LEU2 gene is normally not transcribed and the yeast are auxotrophic for leucine. LexA fusion proteins that activate transcription, bind the operators, activate LEU2 transcription, and allow these strains to grow in the absence of leucine. LexA fusion proteins that do not activate transcription can be used as baits for the trap. Use of transcriptionally inert bait proteins allows one to express in the same strain cDNA-encoded proteins fused to a transcription activation domain, and select those cDNA-encoded proteins that interact with your bait by their ability to cause leucine prototrophy. Because the cDNA fusion is expressed from a galactose-inducible promoter (a GAL1 derivative, see LIBRARIES), it is possible to quickly determine that the leucine prototrophy is dependent upon cDNA expression; cells containing true interactors will grow on media lacking leucine only if it contains galactose but not when it contains glucose. During an interactor hunt we include a second reporter gene in the strain to provide an independent measure of interaction. The second reporter (see REPORTERS) is a plasmid-borne lacZ gene with upstream LexA operators. Yeast containing a cDNA that encodes a true interactor will show galactose dependence of both phenotypes, they will exhibit galactose-dependent growth in the absence of leucine and galactose-dependent blue color on Xgal indicator plates. The strains are auxotrophic for several other markers which respectively allow selection of the bait plasmid (HIS3), the lacZ reporter plasmid (URA3) and the library plasmid (TRP1). The prototype strain is EGY48 (MAT alpha, his3, trp1, ura3, 6LexAop-LEU2). EGY48 has 3 high affinity colE1 LexA operators upstream of the LEU2 gene. Each operator consists of two overlapping LexA binding sites, each of which can bind a dimer of LexA. This makes for a very sensitive reporter of transcription activation by LexA fusions or by proteins interacting with them. However, baits that activate the LEU2 gene in EGY48 cannot be used for the interaction trap. For this reason Erica has also made strains with fewer LexA operators; these allow use of LexA fusions that marginally activate the LEU2 gene in EGY48 as baits. Details Construction A HindIII cassette encoding the URA3 gene was inserted into a derivative of the plasmid pHR33 (a gift of R. Rothstein) to create the yeast integrating plasmid pXLEU2. 1,2, or 3 copies of a BamHI-ended double stranded 42-mer that contained the "overlapping" double LexA operator found upstream of the colecin E1 gene (see below) were inserted into a unique BglII site ~130 bp upstream of the LEU2 translation start site, to generate plasmids 1LexLEU2, 2LexLEU2, and 3LexLEU2. The strain U457 (R. Rothstein)(MATa SUP53-a ade2-1 can1-100 ura3-1 trp1-1 [phi+]) was used as recipient for the LexAoperator-LEU2 plasmids. The trp1-1 mutation is an amber, which is suppressed by the SUP53-a gene, so in fact U457 is "TRP+" for growth. The chromosomal array of genes in this strain is Ty1 element-SUP53-LEU2. Integrating plasmids were cut with Cla I within LEU2 coding sequence, and used to transform U457 to URA3+. ura3- revertants were selected by their ability to form colonies on medium that contained 5-Fluoroorotic acid. ura3-trp1-leu2- yeast derive from recombination events that resolve the integrated plasmid by crossover between Ty1 sequences present on XLEU2 variants and the chromosomal Ty1 element, resulting in loss of the SUP53-a gene and substitution of LexA operator sequences for the LEU2 UAS. ura3- trp1- leu2- colonies containing 0,1,2, or 3 colEI operators upstream of the single chromosomal LEU2 gene were isolated. EGY12 has no LexA operators, EGY17 and EGY18 have one, EGY23 and EGY24 have two, and EGY38 has three. Strains EGY12, EGY17, EGY22 and EGY38 were made his3- by mating these strains to the strain GG100-14D (MATa his3 trp1 pho5); selecting for LEU+, HIS+ diploids: sporulating, and selecting for random spore products that were leu2-, ura3-, trp1-, his3, and GAL+. EGY48, EGY194, and EGY188 are derivatives of EGY38, EGY22, and EGY17, respectively. EGY48 is most commonly used for the interactive library screen described elsewhere. EGY40 is an EGY12 derivative used as negative control. The colE1 operator LexA operator-containing oligonucleotide. Contains very high affinity colE1 sites, which appears to be bound by two LexA dimers. Lower case bases are important for protein contacts (Ebina et al, JBC, 258, 13258-13261 (1983); Kamens et al., MCB, 10, 2840-2847(1990)). This oligonucleotide is double stranded with XhoI sticky 5' overhangs (5'GATC...) at each end; you may have to change the font to show this on your display. 5'GATCCTGctgTATATAAAACcagtgGTTATATGTAcagTACG 3' 3' GACGACATATATTTTGGTCACCAATATACATGTCATGCCTAG 5' Erica Golemis March, 1990 Department of Molecular Biology, MGH and Department of Genetics, Harvard Medical School 50 Blossom Street Boston, Massachusetts 02114 After August 1993 Fox Chase Cancer Research Center Philadelphia, Pennsylvania ea_golemis@fccc.edu Information revised September 1993