REPORTERS

Selection for LEU+ colonies in an interactor hunt results in a certain
number of false positives due to cis or trans-acting yeast mutations
that activate the LEU2 promoter (see EXPECTED RESULTS).  Most of these
can be identified because they grow on glucose plates lacking leucine
and therefore do not depend on expression of the activator containing
protein from the library plasmid which is driven by the GAL1 promoter
(see LIBRARIES).  However, the selection strains for the trap also
incorparate a second reporter, which has LexA operators upstream of a
lacZ gene (see below), to further diminish the frequency of these
apparent positives.  Most yeast that contain library encoded proteins
that interact with the bait will be both galactose-dependent LEU+ and
galactose-dependent blue on Xgal indicator plates.

The LexAop-lacZ reporters are not as sensitive as the Lexop-LEU2
reporter, so it is possible for a weak interactor not to result in
blue yeast on Xgal plates.  To minimize this possibility, for most
hunts we now recommend the use of the most sensitive lacZ reporter
plasmid available, usually (pSH18-34) rather than the less sensitive
ones used previously (pJK103, and pRB1840) (Gyuris et al., submitted;
Zervos et al., January 1993 Cell 72:223-232 ).  Note that these less
sensitive lacZ reporters can be quite useful: activation of their
transcription by a particular interacting bait/prey pair is a function
of the the dissociation constant for that interaction (Golemis and
Brent, in preparation) and demanding activation of weak reporters is a
good way to detect only those interactions that are strong.

pSH18 series -  LexAop-lacZ reporter genes
Steve Hanes

These are reporter plasmids for LexA fusion proteins. They contain
multiple LexA operators upstream of an easily assayable reporter gene,
GAL1-LacZ (the GAL1 regulatory elements have been removed so that
these reporters are not controled by galactose and glucose).  They are
all URA3+ and have 2u replicators.  In E. coli, they all confer amp
resistance.

I made these by inserting a 78-bp oligonucleotide* into the XhoI site
of plasmid pLR1(delta)1 (West et al., MCB 4, 2467 (1984)).  The XhoI
sites are not reconstituted. Insertion site is at -167 from the
transcription start site of GAL1-LacZ.  Inserts are in the 5'-> 3'
orientation.  Operators are the high-affinity "overlapping" sequence
found upstream of colE1 (Ebina et al., JBC 258, 13258). Each
oligonucleotide contains two of these sequences (ie, 4 binding sites
for LexA dimers, or 8 operator half sites).

pSH18-8: One intact insert. 2 LexA operators.

pSH18-3: One and a 'half' inserts (rearranged in vivo). 3 LexA operators.

pSH18-34: Two inserts.  4 LexA operators.

pSH18-34(delta)spe: Integrating derivative of pSH18-34 

Comments: Because of their large numbers of high affinity operators,
these plasmids are currently the most sensitive Lexop-lacZ reporters.
Yeast bearing them have undetectable levels of beta-galactosidase
activity in the absense of activator proteins.  pSH18-34(delta)spe is
a gift of Pam Silver who is now at the Dana Farber Cancer Institute.
It lacks the 2 um replicator and can be directed to the URA3 locus for
chromosomal integration by cutting with ApaI.

    Also available is JK103 (made by Joanne Kamens, Brent lab), which
has a single overlapping colE1 type operator, and the old faithful,
p1840 which has a symmetrically altered version of the lower affinity
recA operator (1 LexA op; Brent and Ptashne, Cell 40, 729.(1985)).
For all of these LexAop reporter plasmids, an appropriate negative
control is pLR1(delta)1, which gives no background in yeast.

*Sequence of the oligonucleotide.  Each oligonucleotide contains 2
colE1 operators or 4 binding sites for LexA dimers.

top strand
 5'TCGACTGCTGTATATAAAACCAGTGGTTATATGTACAGTACTGCTGTATATAAAACCAGTGGTTATATGTACA
GTACG3'

bottom strand
     
3'GACGACATATATTTTGGTCACCAATATACATGTCATGACGACATATATTTTGGTCACCAATATACATGTCATGC
AGCT5'

These anneal to give double stranded DNA with 4bp XhoI 5' sticky ends (TCGA)

Steve Hanes
Department of Molecular Biology
Massachusetts General Hospital
Boston, MA 02114

after September 1, 1993

Axelrod Institute
Wadsworth Laboratories
New York State Department of Health
Empire State Plaza
Albany, New York 12201

518-474-2821
hanes@wadsworth.ph.albany.edu


Information revised September 1993

Roger Brent
brent@opal.mgh.harvard.edu