MAKING BAITS LexA fusions proteins ("baits") are typically expressed from pEG202. Protein coding sequences can be inserted into this plasmid in a polylinker downstream of the region encoding full length LexA (amino acids 1 to 202, including the DNA-binding domain and the dimerization domain). Although LexA does not contain a functional yeast nuclear localization signal, it and most fusions to it will be equally partitioned between the cytoplasm and nucleus (Silver, et al. (1986) MCB 6:4763-4766) (see TESTING BAITS). Thus, most baits will occupy LexA operators in the yeast nucleus (Golemis and Brent, 1992 MCB 12:3006-3014). A small minority of baits are excluded from the nucleus (for example, LexA-Oskar; Breitwieser and Ephrussi, personal communication). For these rare baits, we have available a close relative of pEG202, a gift of Bert Vogelstein and his coworkers, which carries the SV40 T nuclear localization signal between LexA and the polylinker. We also have a pEG202-related plasmid for making fusions to the N-terminus of LexA, a gift of Manuel Sainz and Vicki Chandler. This vector can be used in those cases where it is suspected that the N-terminal region of a protein may be important for interaction. LexA-Fusion Expression Plasmid, pEG202. Erica A. Golemis pEG202 is a derivative of the plasmid LexA202+PL (Ruden et al., Nature 350:250-252 (1991)) which increases the number of unique polylinker sites available for cloning. To create this plasmid, LexA202+PL was cut at the unique SalI cloning site downstream of LexA in the polylinker, and a 22mer with the sequence 5' TCGACCATGGCGGCCGCTCGAG GGTACCGCCGGCGAGCTCAGCT 5' was inserted (note that this double stranded oligo has sticky 5'GATC Sal ends; to see this, you may have to display this using a constant-spaced font) . This oligo thus recreates flanking SalI sites, and adds novel unique sites for NcoI, NotI, and XhoI. The total pEG202 polylinker sequence reads in frame from the last codon of LexA as follows: CTG GAA TTC CCG GGG ATC CGT CGA CCA TGG CGG CCG CTC GAG TCG ACC LexA ECORI SmaI BAMHI SALI NCOI NOTI XHOI SALI TGC AGC C. PstI All sites indicated in capital letters are usable for inserting fusion sequences (PstI and SmaI are not unique). This plasmid contains the 2um origin and a HIS3 selectable marker and the E.coli amp resistance gene. Expression of the LexA-fusion cassette is from the strong constitutive ADH1 promoter. Primers for sequencing and/or PCR can be constructed from the LexA and ADH1 terminator sequences flanking the polylinker sites (see SEQUENCES). There are stop codons present in all reading frames approximately 20 codons downstream of the PstI site. Erica Golemis ea_golemis@fccc.edu June 1992 revised September 1993